View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3845_low_21 (Length: 239)
Name: NF3845_low_21
Description: NF3845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3845_low_21 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 14928934 - 14929156
Alignment:
| Q |
17 |
atagacaagccattgctgattacaacagtttggtgaagaatctgttgtttgctgttgagtgtattactgagttggaaaagctttcaacaaaagggtatga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14928934 |
atagacaagccattgctgattacaacagtttggtgaagaatctgttgtttgctgttgagtgtattactgagttggaaaagctttcaacaaaagggtatga |
14929033 |
T |
|
| Q |
117 |
acataaagatgttcctgctttgtctgaagctatgcaagagattcctgttgctgtttattgggctatcattactgctattatttgtgctaatcatcttgat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14929034 |
acataaagatgttcctgctttgtctgaagctatgcaagagattcctgttgctgtttattgggctatcattactgctattatttgtgctaatcatcttgat |
14929133 |
T |
|
| Q |
217 |
cttcttttcggtgattcgtaagt |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14929134 |
cttcttttcggtgattcgtaagt |
14929156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 177
Target Start/End: Original strand, 33237295 - 33237348
Alignment:
| Q |
124 |
gatgttcctgctttgtctgaagctatgcaagagattcctgttgctgtttattgg |
177 |
Q |
| |
|
||||||||| |||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
33237295 |
gatgttccttctttgtctgatgcattgcaagatattcctgttgctgtttattgg |
33237348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University