View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3845_low_7 (Length: 385)
Name: NF3845_low_7
Description: NF3845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3845_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 9e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 11202484 - 11202649
Alignment:
| Q |
1 |
atgatgatgatgaagatgaggatggggtgagggattcgctatctacgaagatgataaaggagcagcaagaggagagtggtcgcatcagaaaagctattgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202484 |
atgatgatgatgaagatgaggatggggtgagggattcgctatctacgaagatgataaaggagcagcaagaggagagtggtcgcatcagaaaagctattgc |
11202583 |
T |
|
| Q |
101 |
ttcaaggtttgattttgataaatttgatacattattcattaattgcctgtgttatgttatgttgtg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202584 |
ttcaaggtttgattttgataaatttgatacattattcattaattgcctgtgttatgttatgttgtg |
11202649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 266 - 374
Target Start/End: Original strand, 11202749 - 11202857
Alignment:
| Q |
266 |
aattgaataattgaagcaatgggttgtgtttattttgatttcaatgtgactcttttggctaaattgactgatttgggtgtgttatttagggttaaattgg |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202749 |
aattgaataattgaagcaatgggttgtgtttattttgatttcaatgtgactcttttggctaaattgactgatttgggtgtgttatttagggttaaattgg |
11202848 |
T |
|
| Q |
366 |
atggtgatg |
374 |
Q |
| |
|
||||||||| |
|
|
| T |
11202849 |
atggtgatg |
11202857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University