View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3846_high_10 (Length: 377)
Name: NF3846_high_10
Description: NF3846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3846_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-103; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 152 - 362
Target Start/End: Complemental strand, 27245082 - 27244873
Alignment:
| Q |
152 |
taattggtaagtatgtatcatctaaacattgattcaaaccttttctaatgcgtcttctgcattttgggcaatcttctctacatcttctgctacgttttca |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27245082 |
taattggta-gtatgtatcatctaaacattgattcaaaccttttctaatgcgtcttctgcattttgagcaatcttctctacatcttctgctacgttttca |
27244984 |
T |
|
| Q |
252 |
acaaattcagcaacaactcgtcgttttcctttgggaagattctttacagttctttctgccatcttgtccaccctttcagccacttcttctacaatgtttg |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27244983 |
acaaattcagcaacaactcgtcgttttcctttgggaagattctttgcagttctttctgccatcttgtccaccctttcagccacttcttccacaatgtttg |
27244884 |
T |
|
| Q |
352 |
ctacttgttct |
362 |
Q |
| |
|
||||||||||| |
|
|
| T |
27244883 |
ctacttgttct |
27244873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 27245257 - 27245199
Alignment:
| Q |
15 |
ggacaaagacatatcacatatgccaaactaagcagaaactaagacgtaaagaatgtctt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27245257 |
ggacaaagacatatcacatatgccaaactaagcagaaactaagacgtaaagaatgtctt |
27245199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 27245152 - 27245112
Alignment:
| Q |
120 |
cccatggacatataaattatgtttcttaaaagtaattggta |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27245152 |
cccatggacgtataaattatgtttcttaaaagtaattggta |
27245112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University