View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3846_high_16 (Length: 247)
Name: NF3846_high_16
Description: NF3846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3846_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 1160229 - 1160016
Alignment:
| Q |
19 |
agcagctgcaggaattatcggcggtgcagtggctggtggagttgctggtggagtggttggtggtgcagtcgccaatcacgggcacaattatgaacacaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1160229 |
agcagctgcaggaattatcggcggtgcagtggctggtggagttgctggtggagtggttggtggtgcagtcgccaatcacgggcacaattatggacacaaa |
1160130 |
T |
 |
| Q |
119 |
caccttcatgtttgtgtcccaacatttattttatgtttgagttttttgctttaatcatgttgttttacttccacagctaattaagtatcatgtttagttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1160129 |
caccttcatgtttgtgtcccaacatttattttatgtttgagttttttgctttaatcatgttgttttacttcca---ctaattaagtatcatgtttagttg |
1160033 |
T |
 |
| Q |
219 |
cttctgtttaggcctat |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1160032 |
cttctgtttaggcctat |
1160016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 192
Target Start/End: Complemental strand, 1141737 - 1141671
Alignment:
| Q |
126 |
atgtttgtgtcccaacatttattttatgtttgagttttttgctttaatcatgttgttttacttccac |
192 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| | | ||||||| |||||| |||||||| |
|
|
| T |
1141737 |
atgtttgtgtctcaacatttattttatgtttgagcttttggttataatcatattgtttcacttccac |
1141671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 126 - 192
Target Start/End: Complemental strand, 1137083 - 1137017
Alignment:
| Q |
126 |
atgtttgtgtcccaacatttattttatgtttgagttttttgctttaatcatgttgttttacttccac |
192 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| |||| |||||||| | |||||| |||||||| |
|
|
| T |
1137083 |
atgtttgtgtctcaacatttcttttatgtttgagcttttggctttaattacattgtttcacttccac |
1137017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University