View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3846_high_26 (Length: 222)
Name: NF3846_high_26
Description: NF3846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3846_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 12 - 204
Target Start/End: Original strand, 36586220 - 36586418
Alignment:
| Q |
12 |
caaaggtacaaaatttgctttcaatttcctttcttagccactctgtccaatccaatgttctgggttcatgagtggatgtacccctttttaccctcttttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36586220 |
caaaggtacaaaatttgctttcaatttcctttcttagccactctgtccaatccaatgttctgggttcatgagtggatgtacccctttttaccctcttttt |
36586319 |
T |
 |
| Q |
112 |
tgctttcacttgctccgtaaatgaaggtgtctttatctcctctatctctttct------ctttcccataccctatcaataaatctttaagcaccaatca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36586320 |
tgctttcacttgctccgtaaatgaaggtgtctttatctcctctatctctttctctttccctttcccataccctatcaataaatctttaagcaccaatca |
36586418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University