View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3846_high_27 (Length: 217)
Name: NF3846_high_27
Description: NF3846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3846_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 37 - 202
Target Start/End: Original strand, 34627900 - 34628067
Alignment:
| Q |
37 |
atttaggcccttggtcttttggtatatgaataggaaaacagatttctttattataatgtaaaaagacaatatagccnnnnnnnnnt--ccaacaccgtga |
134 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
34627900 |
atttaggcccttggtcttttgttatatgaataggaaagcagatttctttattataatgtaaaaagacaatatagccaaaaaaaaatatccaacaccgtga |
34627999 |
T |
 |
| Q |
135 |
caaaagagctaacattatattgtagaataaattaatctttccatttgttaatatgtctaggtaaaatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34628000 |
caaaagagctaacattatattgtagaataaattaatctttccatttgttaatatgtctaggtaaaatg |
34628067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 34627847 - 34627875
Alignment:
| Q |
13 |
cagagaagctttatgaaaataccaattta |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34627847 |
cagagaagctttatgaaaataccaattta |
34627875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University