View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3846_low_9 (Length: 395)
Name: NF3846_low_9
Description: NF3846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3846_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 19 - 380
Target Start/End: Complemental strand, 9080023 - 9079664
Alignment:
| Q |
19 |
atgacatatacaatatgtctaatctcatgtgatatatgtgtggctttcataaatccaaacttccaaccattggcaatggcatatgcttacatattaacca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9080023 |
atgacatatacaatatgtctaatctcatgt-atgcatgtgtggctttcataaatccaaacttccaaccattggcaatggcatatgcttacatattaacca |
9079925 |
T |
|
| Q |
119 |
atggttctaccaatttcattatcatccctttctcacaactaccgtatacacaatcatatcatatcatatcaaaataaattttgggccaactagtttctga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9079924 |
ttggttctaccaatttcattatcatccctttctcacaactaccgtatacacaatcatatcatatcatatcaaaataaattttgggccaactagtttctga |
9079825 |
T |
|
| Q |
219 |
aaactcacgaatatttgctatcatatatgataccctatctaattctattgccttaggttttaaatttttagataagctaaacaaatttattgaaacattt |
318 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9079824 |
aaactcacgaatattcgctatcatatatgataccctatctaaatctattgccttaggttttaaatttttagataagctaaacaaatttattgaaacattt |
9079725 |
T |
|
| Q |
319 |
aaagaacatgtaaacttagggatgaatccaattataaaagttgagtttaccctaactctatt |
380 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9079724 |
aaagaacatgt-aacttagggatgaatcaaattataaaagttgagtttaccctaactctatt |
9079664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University