View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3847_high_10 (Length: 239)
Name: NF3847_high_10
Description: NF3847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3847_high_10 |
 |  |
|
| [»] scaffold0649 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0649 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0649
Description:
Target: scaffold0649; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 4733 - 4953
Alignment:
| Q |
19 |
acatcaccctgtgttcgtctaatgacggctatttcacactccatcctttcccaatacgtagtttactcgagaatcggtttatggatcatcctgatcacta |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4733 |
acatcacactgtgttcgtctaatgacggctttttcacactccatcctttcccaatacgtagtttactcgagaatcggtttatggatcatcctgatcacta |
4832 |
T |
 |
| Q |
119 |
ccaattcgtggaccggggatgtaacggatttgttggttcatgcaatggattgatatgcatgctcagtgatcgcatcgatggtaagtatcaaagctcttgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4833 |
ccaattcgtggaccggggatgtaacggatttgttggttcatgcaatggattgatatgcatgctcagtgatcgtatcgatggtaagtatcaaagctcttgc |
4932 |
T |
 |
| Q |
219 |
ctccgtttctggaacccggcc |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4933 |
ctccgtttctggaacccggcc |
4953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 187
Target Start/End: Original strand, 20980028 - 20980064
Alignment:
| Q |
151 |
ttggttcatgcaatggattgatatgcatgctcagtga |
187 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
20980028 |
ttggttcctccaatggattgatatgcatgctcagtga |
20980064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University