View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3847_high_4 (Length: 362)
Name: NF3847_high_4
Description: NF3847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3847_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 132 - 296
Target Start/End: Complemental strand, 6033266 - 6033102
Alignment:
| Q |
132 |
ctaattaaaactatgtaaattatattggatctgctagaaatatagttgaactttaatttatataatataacatcaaccacactttaaatattggctagaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6033266 |
ctaattaaaactatgtaaattatattggatctgctagaaatatagttgaactttaatttatataatataacatcaaccacactttaaatattggctagaa |
6033167 |
T |
 |
| Q |
232 |
ataatacacgcagcatataaatcctttgaagccaaactgtcacatgcccttggcagatctttgag |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6033166 |
ataatacacgcagcatataaatcctttgaagccaaactgtcacatgcccttggcagatctttgag |
6033102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University