View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3847_high_6 (Length: 255)
Name: NF3847_high_6
Description: NF3847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3847_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 8456716 - 8456530
Alignment:
| Q |
1 |
cagtaatagcaacatcaacaatattatgtatgattactatggaacaaccttgtcttgaacannnnnnnnnnnnnnnnnnnattatcatattaaggaggta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8456716 |
cagtaatagcaacatcaacaatattatgtatgattactatggaacaaccttgtcttgaacattcttcttcttcttct---attatcatattaaggaggta |
8456620 |
T |
|
| Q |
101 |
tgacaacatgagaatttacctgaaaaagtatttcctttccatctcgcaaaactgcagctggctcttggtgtgaagaaagattgatgactt |
190 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
8456619 |
tgacaacatgagactttacctgaaaaagtatttcctttccatctcgcaaaactgcatctggcccttggtgtgaagaaagattgatgactt |
8456530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 240
Target Start/End: Complemental strand, 8456513 - 8456480
Alignment:
| Q |
207 |
ggattgatgagaagatgagctgaatagtatatag |
240 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
8456513 |
ggattgatgagaagatgagctcaatagtatatag |
8456480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University