View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3847_high_9 (Length: 241)
Name: NF3847_high_9
Description: NF3847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3847_high_9 |
 | |
|
| [»] scaffold0649 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0649 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold0649
Description:
Target: scaffold0649; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 241
Target Start/End: Complemental strand, 5408 - 5181
Alignment:
| Q |
14 |
aggcaatctgccaatacgcaaacaattggcataatcggtggtatttcagcaaaatctagaggtacgagcaactgtgtgcattcgtccgtccccaaatcaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5408 |
aggcaatctgccaatacgcaaacaattggcataataggtggtatttcatcaaaatctagaggtacgagcaactgtgtgcattcctccgtccccaaatcaa |
5309 |
T |
|
| Q |
114 |
gcgagataatgccaaattgttcaatcgtatcgttaagatctttccaatccgagtaaagataaacaatgttattgcaaagggtaaaccaattaagactgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5308 |
gcgagataatgccaaattgttcaatcgtatcgttaagatctttccaatccgagtaaagataaacaatgttattgcaaagggtaaaccaattaagactgtt |
5209 |
T |
|
| Q |
214 |
gctaaaatagacaccaccattctgatcc |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5208 |
actaaaatagacaccaccattctgatcc |
5181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 101 - 142
Target Start/End: Original strand, 15572097 - 15572138
Alignment:
| Q |
101 |
gtccccaaatcaagcgagataatgccaaattgttcaatcgta |
142 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
15572097 |
gtccccaaatcaagcgagattatcacaaattgttcaatcgta |
15572138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University