View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3847_low_5 (Length: 314)
Name: NF3847_low_5
Description: NF3847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3847_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 20 - 304
Target Start/End: Original strand, 35696754 - 35697038
Alignment:
| Q |
20 |
cttagttcttcggctgttgaatattatgatataacgaagcctaacaaacagaatcaaaactatgacaataacagtaattgtgatgccaagcatatgatga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696754 |
cttagttcttcggctgttgaatattatgatataacgaagcctaacaaacagaatcaaaactatgacaataacagtaattgtgatgccaagcatatgatga |
35696853 |
T |
|
| Q |
120 |
cgcttcaacgatcacaaagcgnnnnnnntgattcgacgattaatgattatgtttataatcctaatggaaaaaacggttacggtggtgaatgtgagtctga |
219 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696854 |
cgcttcaacgatcacaaagcgaaaaaaatgattcgacgattaatgattatgtttataatcctaatggaaaaaacggttacggtggtgaatgtgagtctga |
35696953 |
T |
|
| Q |
220 |
aattagtgttcctactgggaagaaaggtgtgatcgtgaacgcgaatggatcgttgtgttcggatgttggaccttcaccgtctgtg |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696954 |
aattagtgttcctactgggaagaaaggtgtgatcgtgaacgcgaatggatcgttgtgttcggatgttggaccttcaccgtctgtg |
35697038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University