View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3848_low_4 (Length: 252)

Name: NF3848_low_4
Description: NF3848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3848_low_4
NF3848_low_4
[»] chr1 (1 HSPs)
chr1 (132-238)||(39504097-39504203)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 132 - 238
Target Start/End: Complemental strand, 39504203 - 39504097
Alignment:
132 ttattagacttgccagctcaagaacatgatattgtgcttttatgtgatctggaagccattgatcgagaacagccgtactctttttggttgtcgtcactat 231  Q
    |||||||||||||||  |||||||||||||| ||  ||||||||||||||||||||||||||||||||||||||| || |||||||||||  ||||||||    
39504203 ttattagacttgccatttcaagaacatgatactgcacttttatgtgatctggaagccattgatcgagaacagccgcaccctttttggttgcagtcactat 39504104  T
232 cttttct 238  Q
    |||||||    
39504103 cttttct 39504097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University