View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3849_high_13 (Length: 406)
Name: NF3849_high_13
Description: NF3849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3849_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 31 - 391
Target Start/End: Complemental strand, 47591296 - 47590936
Alignment:
| Q |
31 |
ttcaccttagaattgaactcaggtacaagccaaactattcaattcaactttagatgaagtgcagacaccacttgagttctattacttgattatcattgat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47591296 |
ttcaccttagaattgaactcaggtacaagccaaactattcaattcaactttagatgaagttcagacaccacttgagttctattacttgattatcattgat |
47591197 |
T |
 |
| Q |
131 |
tttttatatggcttgaagatattttggaagagagatagatgaattgagtcatgtaatattagttgaatgaaacttcacctttaattgttggaggagggct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47591196 |
tttttatatggcttgaagatattttggaagagagatagatgaattgagtcatgtaatattagttgaatgaaacttcacctttaattgttggaggagggct |
47591097 |
T |
 |
| Q |
231 |
aacttgcccaaacatctctggttcatcatcgttgttgtagaattgggacaatccaaacatcatatagcagctaggatatagaatttttccctctggactt |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47591096 |
aacttgcccaaacatctctggttcatcatcgttgttgtagaattgggacaatccaaacatcatatagcagctaggatatagaatttttccctctggactt |
47590997 |
T |
 |
| Q |
331 |
gccaaactactccaaggaatttcattttggaaaatgttttgcaggcaggctctgcaatctg |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47590996 |
gccaaactactccaaggaatttcattttggaaaatgttttgcaggcaggctctgcaatctg |
47590936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University