View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3849_high_36 (Length: 227)
Name: NF3849_high_36
Description: NF3849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3849_high_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 7 - 151
Target Start/End: Complemental strand, 6368519 - 6368365
Alignment:
| Q |
7 |
caggattgactggcagagggattcccaacagtgtctccatctnnnnnnnnccatggttgttgtgttgtttgttgctttgaataaaagatgagaaggtgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6368519 |
caggattgactggcagagggattcccaacagtgtctccatctaaaaaacaccatggttgttgtgttgtttgttgctttgaataaatgatgagaaggtgtt |
6368420 |
T |
 |
| Q |
107 |
gaacgtgtgta----------ttacttccagctgcactatttgaccaagtctcta |
151 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6368419 |
gaacatgtgtatcatcagttgttacttccagctgcactatttgaccaagtctcta |
6368365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 7 - 102
Target Start/End: Complemental strand, 6389501 - 6389406
Alignment:
| Q |
7 |
caggattgactggcagagggattcccaacagtgtctccatctnnnnnnnnccatggttgttgtgttgtttgttgctttgaataaaagatgagaagg |
102 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
6389501 |
caggattgactttcagaggcattcccaacagtgtctccatctagaaaatgtcatggttgttttgttgtttcttgctttgaataaaagatgagaagg |
6389406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 7 - 102
Target Start/End: Complemental strand, 6408750 - 6408655
Alignment:
| Q |
7 |
caggattgactggcagagggattcccaacagtgtctccatctnnnnnnnnccatggttgttgtgttgtttgttgctttgaataaaagatgagaagg |
102 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
6408750 |
caggattgactttcagaggcattcccaacagtgtctccatctagaaaatgtcatggttgttttgttgtttcttgctttgaataaaagatgagaagg |
6408655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 6361743 - 6361703
Alignment:
| Q |
8 |
aggattgactggcagagggattcccaacagtgtctccatct |
48 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
6361743 |
aggattgacttgcagaggcattcccaacagtgtctctatct |
6361703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 7457599 - 7457559
Alignment:
| Q |
8 |
aggattgactggcagagggattcccaacagtgtctccatct |
48 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
7457599 |
aggattgacttccagaggcattcccaacagtgtctccatct |
7457559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University