View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3849_high_38 (Length: 205)
Name: NF3849_high_38
Description: NF3849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3849_high_38 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 4 - 205
Target Start/End: Complemental strand, 3714715 - 3714514
Alignment:
| Q |
4 |
actcttcgaactcttttacctgtgttattcttcatgcatgcatatcnnnnnnnatgttcattttgacttcatattgaacaatataagattttgattttat |
103 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3714715 |
actctttgaactcttttacctgtgttattcttcatgcatgcatatcttttttgatgttcattttgactgcatattgaacaatataagattttgattttat |
3714616 |
T |
 |
| Q |
104 |
tcatgaaagttctcctaccgtctattgtgggaaccgagtcagtgtatggtgaaataaataatatattagtccttaatatactaccaagtactaacttttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
3714615 |
tcatgaaagttctcctaccgtctattgtgggaaccgagtcagtgtatggtgaaataaataatatatcagtccttaatataccaccaagtactaacttttt |
3714516 |
T |
 |
| Q |
204 |
ct |
205 |
Q |
| |
|
|| |
|
|
| T |
3714515 |
ct |
3714514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University