View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3849_low_19 (Length: 352)
Name: NF3849_low_19
Description: NF3849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3849_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 37320345 - 37320171
Alignment:
| Q |
14 |
tatcaaaggcctaatcaccgtccccctacacaggctccctctcatgattattcacggccgaataggaagttggataggagatattcaaggattgctgatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320345 |
tatcaaaggcctaatcaccgtccccctacacaggctccctctcatgattattcacggccgaataggaagttggataggagatattcaaggattgctgatg |
37320246 |
T |
 |
| Q |
114 |
attatcattctctcgacgaggtaattaattaagattgttgtgttgttatgatttactagtctgtacttgtcatgttttt |
192 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320245 |
attatcattctctcgacgaggtaa----ttaagattgttgtgttgttatgatttactagtctgtacttgtcatgttttt |
37320171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 185 - 312
Target Start/End: Complemental strand, 37320110 - 37319983
Alignment:
| Q |
185 |
atgtttttgtttgttaatgtcatagactttgtggttggtaaaggaaagggaaaggagacactgacttgataaaggtaatatgtgtggatagcattaaaca |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320110 |
atgtttttgtttgttaatgtcatagactttgtggttggtaaaggaaagggaaaggagacactgacttgataaaggtaatatgtgtggatagcattaaaca |
37320011 |
T |
 |
| Q |
285 |
aaaaagaaagggaatcattttttgtttc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37320010 |
aaaaagaaagggaatcattttttgtttc |
37319983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University