View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3849_low_22 (Length: 335)
Name: NF3849_low_22
Description: NF3849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3849_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 4 - 318
Target Start/End: Complemental strand, 47590859 - 47590545
Alignment:
| Q |
4 |
ataattcttaatggttctatcccctgtctgtaaattccccacttcatgtaagatatctgccagtttccaagttgtgaatctatgcagcaggttgaggtta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47590859 |
ataattcttaatggttctatcccctgtctgtaaattccccacttcatgtaagatatctgccagtttccaagttgtgaatctatgcagcaggttgaggtta |
47590760 |
T |
|
| Q |
104 |
gaactattggccaaattgaattggtgaaattttggagcacttgtatcaatacgtgaaaggagagaatgataggaatatcggagtaaacatttatcgtacc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47590759 |
gaactattggccaaattgaattggtgaaattttggagcacttgtatcaatacgtgaaaggagagaatgataggaatagcggagtaaacatttatcgtacc |
47590660 |
T |
|
| Q |
204 |
aaattatagcctctttggaggaagggcactccgataatattctttttgttgcatgttggatacatagctgacagagggtaggggagatggagatatcacc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47590659 |
aaattatagcctctttggaggaagggcactccgataatattctttttgttgcatgttggatacatagctgacagagggtaggggagatggagatatcacc |
47590560 |
T |
|
| Q |
304 |
acggctcataaagag |
318 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
47590559 |
acggcacataaagag |
47590545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University