View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3849_low_33 (Length: 261)
Name: NF3849_low_33
Description: NF3849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3849_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 50 - 245
Target Start/End: Complemental strand, 31661297 - 31661100
Alignment:
| Q |
50 |
attaagagcctatttttactatgagagccgaacctccaattcataggaacagccccgaggcattataaaatgcttaatttaggttagagcaaaacaagaa |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31661297 |
attaagagcctatttttactatgagagccgaacttccaattcataggaacggccccgaggcattataaaatgcttaatttaggttagagcaaaacaagaa |
31661198 |
T |
 |
| Q |
150 |
agtatgatggttatatatattgt--taannnnnnnnnatcgtgatattggtacgacgtttataccgctgtacataaatgactaaccttcgttggggag |
245 |
Q |
| |
|
||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
31661197 |
agtatgatggttatatatattgttgttatttttttttatcgtgatattggtacgacgtttataccgctgtatataaatgactaaccttcgctggggag |
31661100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University