View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3849_low_33 (Length: 261)

Name: NF3849_low_33
Description: NF3849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3849_low_33
NF3849_low_33
[»] chr8 (1 HSPs)
chr8 (50-245)||(31661100-31661297)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 50 - 245
Target Start/End: Complemental strand, 31661297 - 31661100
Alignment:
50 attaagagcctatttttactatgagagccgaacctccaattcataggaacagccccgaggcattataaaatgcttaatttaggttagagcaaaacaagaa 149  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
31661297 attaagagcctatttttactatgagagccgaacttccaattcataggaacggccccgaggcattataaaatgcttaatttaggttagagcaaaacaagaa 31661198  T
150 agtatgatggttatatatattgt--taannnnnnnnnatcgtgatattggtacgacgtttataccgctgtacataaatgactaaccttcgttggggag 245  Q
    |||||||||||||||||||||||  | |         |||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||    
31661197 agtatgatggttatatatattgttgttatttttttttatcgtgatattggtacgacgtttataccgctgtatataaatgactaaccttcgctggggag 31661100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University