View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3849_low_37 (Length: 243)
Name: NF3849_low_37
Description: NF3849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3849_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 10 - 228
Target Start/End: Complemental strand, 17355447 - 17355229
Alignment:
| Q |
10 |
attattctcgaaggtaagcgatgttgtgattcatacttttgggtttcaactttttgatataatgtcttcaaacactatttgtttacattctaggcgactt |
109 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17355447 |
attattttcgaaggtaaacgatgttgtgattcatacttttgggtttcaattttttaatataatttcttcaaacactatttgtttacattctaggtgactt |
17355348 |
T |
 |
| Q |
110 |
taggcggaaagaaaaatagaacacgcagtctgtaagagaattctcaaccaaggggtattgcggcaatgttggaatctaaagaaatgatgtcgctcgaatc |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17355347 |
taggtggaaagaaaaatagaacacgcagtctataagagaattctcaaccaaggggtagtgcggcaatgttggaatctaaagaaatgatgtcgctcgaatc |
17355248 |
T |
 |
| Q |
210 |
ttaccagaatcaagctaat |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
17355247 |
ttaccagaatcaagctaat |
17355229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University