View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3849_low_40 (Length: 229)
Name: NF3849_low_40
Description: NF3849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3849_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 17 - 214
Target Start/End: Complemental strand, 26307009 - 26306810
Alignment:
| Q |
17 |
caaattcatgtttgtaacatcatgttcatgatgttatttgttatgc--cttc---aataataaatgatatggtagtgcctaccaacacgacatcgacaca |
111 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| || | ||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26307009 |
caaattcatgtttataacatcatgttcatgatgttatttgttatgctactagcctactaatacatgatatggtagtgcctaccaacgcgacatcgacaca |
26306910 |
T |
 |
| Q |
112 |
tgttaatgttacattcatgtctttccatgtcaatatgtcattgttgtgttcggcgtctgtgtcagtgcttcatagagtagtattcatgtgttcagcgtct |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
26306909 |
tgttaatgttgcattcatgtctttccatgtcaatatgtcattgttgtgttcggcgtctgtgtcagtgcttcatagagtag---tcatgtgttcggcgtct |
26306813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University