View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3850_low_9 (Length: 293)
Name: NF3850_low_9
Description: NF3850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3850_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 87 - 176
Target Start/End: Complemental strand, 33525631 - 33525542
Alignment:
| Q |
87 |
gcataaccatgaaccattttgagaacacagctcttgatgattcgctgtcacgatgagtctcttctacaccaacatgatcgttataataca |
176 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525631 |
gcatcaccatgaaccattttgagaacacagctcttgatgattcgctgtcgcgatgagtctcttctacaccaacatgatcgttataataca |
33525542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 233 - 277
Target Start/End: Complemental strand, 33525485 - 33525441
Alignment:
| Q |
233 |
gttgagatatcggttccagagaaggatccaaagcaacgaaggtca |
277 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525485 |
gttgtgatatcggttccagagaaggatccaaagcaacgaaggtca |
33525441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University