View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3852_low_18 (Length: 347)
Name: NF3852_low_18
Description: NF3852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3852_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 20479464 - 20479625
Alignment:
| Q |
1 |
ctttacggggcattcctgtttcatgattcattgttatttttgttacttcttggttctgtctggacggattcgattagtctggggagttgttgtacttgat |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20479464 |
ctttacggggcattcctgtttcatggttcattgttatttttgttacttcttggttctgtctggacggattcgattagtctggggagttgttgtacttgat |
20479563 |
T |
 |
| Q |
101 |
tttttgaggccgttttttcggtgtcagttgaagcgcttttagagtgatcaaagttctgctgc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20479564 |
tttttgaggccgttttttcggtgtcagttgaagcgcttttagagtgatcaaagttctgctgc |
20479625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 239 - 339
Target Start/End: Original strand, 20479702 - 20479802
Alignment:
| Q |
239 |
ccctctgtacatttcctagttggtgtaggtgcttccgtcttaaaagggtgtgtagtggatgtttcggtcctaattttgtagctgatcttgtcctctctgc |
338 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20479702 |
ccctctgtacatttcctagttggtgtatgtgtttcggtcttaaaagggtgtgtagtggatgtttcggtcctaattttgtagcctatcttgtcctctctgc |
20479801 |
T |
 |
| Q |
339 |
t |
339 |
Q |
| |
|
| |
|
|
| T |
20479802 |
t |
20479802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University