View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3852_low_21 (Length: 296)
Name: NF3852_low_21
Description: NF3852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3852_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 273
Target Start/End: Original strand, 29009018 - 29009272
Alignment:
| Q |
19 |
gtaacagtgtcaaatgaaattgaagaattagtttcagtgaaaatagtagcgtgcaaatgcaaattatatagaaatgtgaaggtgaatttgaataaaatga |
118 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29009018 |
gtaacagtatcaaatgcaattgaagaattagtttcagtgaaaattgtagcgtgcaaatgcaaattatatagaaatgtgaaggtgaatttgaataaaatga |
29009117 |
T |
 |
| Q |
119 |
aaccagaatcggaatttgaagaatttaatcaagaagttgaagcgaacatatatgatctttgcgcggttgaagagtttgttatgaattcagaacagagaat |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29009118 |
aaccagaatcggaatttgaagaatgtaatcaagaagttgaagcgaacctatatgatctttgcgcggttgaagagtttgttatgaattcagaacagagaat |
29009217 |
T |
 |
| Q |
219 |
ttggttatgtacctgcaaattcagaaagtgaaatctcagagcaatgaagaagaag |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29009218 |
gtggttatgtacctgcaaattcagaaagtgaaatctcagagcaatgaagaagaag |
29009272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University