View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3855_high_9 (Length: 235)
Name: NF3855_high_9
Description: NF3855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3855_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 17 - 98
Target Start/End: Original strand, 889572 - 889653
Alignment:
| Q |
17 |
aatcataaccgaagacccattttctttgattcctttgattgatgagatgaattcaagtcatgaaaatgaagaacacaaactc |
98 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
889572 |
aatcataaccaaaaacccattttctttgattcctttgattgatgagatgaattcaagtcatgaaaatgaagaacacaaactc |
889653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 889721 - 889758
Alignment:
| Q |
167 |
tagccttaaatatagttaataattacacgtttaccact |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
889721 |
tagccttaaatatagttaataattacacgtttaccact |
889758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University