View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3855_low_10 (Length: 249)
Name: NF3855_low_10
Description: NF3855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3855_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 14 - 239
Target Start/End: Complemental strand, 889530 - 889304
Alignment:
| Q |
14 |
tatatgattcaagggttataccaaaaactgagaaatggggctctagtattaccctaaaatatgtgaagagaaatcaaaaatgggttttttcaaaacnnnn |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
889530 |
tatatgattcaagggttataccaaaaactgagaaatggggctctagtattaccctaaaaaatgtgaagagaaatcaaaaatgggttttttcaaaacaaaa |
889431 |
T |
 |
| Q |
114 |
nnn-ttaacaatgtcttgagaggaataaaatggaagnnnnnnntgaagagaggaagcatatagaaatttaggagagagagaaaaacataccatgaaaatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
889430 |
aaaattaacaatgtcttgagaggaataaaatggaagaaaaaaatgaagagaggaagcatatagaaatttaggagagagagaaaaacataccatgaaaatg |
889331 |
T |
 |
| Q |
213 |
gaacaagttattgaatgaaaccctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
889330 |
gaacaagttattgaatgaaaccctttg |
889304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University