View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3855_low_11 (Length: 235)

Name: NF3855_low_11
Description: NF3855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3855_low_11
NF3855_low_11
[»] chr8 (2 HSPs)
chr8 (17-98)||(889572-889653)
chr8 (167-204)||(889721-889758)


Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 17 - 98
Target Start/End: Original strand, 889572 - 889653
Alignment:
17 aatcataaccgaagacccattttctttgattcctttgattgatgagatgaattcaagtcatgaaaatgaagaacacaaactc 98  Q
    |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
889572 aatcataaccaaaaacccattttctttgattcctttgattgatgagatgaattcaagtcatgaaaatgaagaacacaaactc 889653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 889721 - 889758
Alignment:
167 tagccttaaatatagttaataattacacgtttaccact 204  Q
    ||||||||||||||||||||||||||||||||||||||    
889721 tagccttaaatatagttaataattacacgtttaccact 889758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University