View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_high_38 (Length: 333)
Name: NF3856_high_38
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 20 - 323
Target Start/End: Original strand, 35551748 - 35552051
Alignment:
| Q |
20 |
gccatttcagcagactttcgcaatgaaggaagaggctgtgaccaacttgaatttcgtgaggaagcggaagatctctggcgagtttaacatgatggatccg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35551748 |
gccatttcagcagactttcgcaatgaaggaagaggctgtgaccaacttggatttcgtgaggaagcggaagatctctggcgagtttaacatgatggatccg |
35551847 |
T |
 |
| Q |
120 |
aaaattttcacttgccaacactctacttgtccttatagccaagctcacatcggttttccagacagggcttctagggacactcatcaattgagttgtccat |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35551848 |
aaaattttcacttgccaacactctacatgtccttatagccaagctcacatcggttttccagacagggcttctagggacactcatcaattgagttgtccat |
35551947 |
T |
 |
| Q |
220 |
atagaggctcttcttcatcagattttggtggtccaagttttcatgctaatgaggtaaaaccagtcatatatcctcctcaatcattcgttcaaccgaaacc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35551948 |
atagaggctcttcttcatcagattttggtggtccaagttttcatgctaatgaggtaaaaccagtcatatatcctcctcaatcattcgttcaaccgaaacc |
35552047 |
T |
 |
| Q |
320 |
tatg |
323 |
Q |
| |
|
|||| |
|
|
| T |
35552048 |
tatg |
35552051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University