View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_high_49 (Length: 289)
Name: NF3856_high_49
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_high_49 |
 | |
|
| [»] scaffold0011 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0011 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 82 - 262
Target Start/End: Original strand, 230589 - 230768
Alignment:
| Q |
82 |
ttcaaaacattgttgctaagcttctttcttgttgtcctattttggcaattttccaggctattgatgctctagttattggaagagttgtgacttctgggaa |
181 |
Q |
| |
|
||||||||| |||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
230589 |
ttcaaaacaatgttgctaagcttctt-cttattgtcctattttggcacttttccaggctattgatgctctagttattggaagagttgtgacttctgggaa |
230687 |
T |
|
| Q |
182 |
tgctaagtttgagaaagataatttggttatgggagtattcacttgggctgagtacagtgtagttaaggaacaaagcatcat |
262 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
230688 |
tgctaagtttgagaaagatgatttggttatgggagtattcacttgggctgagtacagtgtggttaaggaacaaagcatcat |
230768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University