View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_high_68 (Length: 241)
Name: NF3856_high_68
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_high_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 24 - 226
Target Start/End: Original strand, 10122227 - 10122422
Alignment:
| Q |
24 |
aatagttacatgcttaacacatagcacaatttgggtatgtacagtgccaagttcaaaggacagtactaggggtagggtatgcaggcaacgttttcacaac |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
10122227 |
aatagttacatgcttaacacatagcacaatttgaggatgtacagtgccaagttcaaaggacagtactaggg------tatgcaggcaacgttt-cacaac |
10122319 |
T |
 |
| Q |
124 |
catataattcactcactttattatggatagtatttgcagtatttgaactctttcaaaatcaccattcagtttcccttcactaatcactagccagccccct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10122320 |
catataattcactcactttattatggatagtatttgcagtatttgaactctttcaaaatcaccattcagtttcccttcactaatcactagccagccccct |
10122419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University