View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_high_77 (Length: 221)
Name: NF3856_high_77
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_high_77 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 47123331 - 47123111
Alignment:
| Q |
1 |
gagcaaaagaggtatttagcttatggcagtttgcacacaaggagacgcacaacagaaaacagacaagtcgaattgaaaacacgggttggatgcttccttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47123331 |
gagcaaaagaggtatttagcttatggcagtttgcacacaaggagacgcacaacagaaaacagacaagtcgaattgaaaacacgggttggatgcatccttt |
47123232 |
T |
|
| Q |
101 |
atgactatgtaatgtgtaatcttgatgtagccatcttctcaaccatgaagaaagtgggtatgactgtttgtcttagagatgtcgaatgacatttcaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
47123231 |
atgactatgtaatgtgtaatcttgatgtagccatcttctcaaccatgaagaaagtgagtatgactgtttgtcttagagatgtagaataacatttcaaaaa |
47123132 |
T |
|
| Q |
201 |
gacatacaatatttggtgcac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47123131 |
gacatacaatatttggtgcac |
47123111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University