View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_23 (Length: 431)
Name: NF3856_low_23
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 203 - 423
Target Start/End: Original strand, 32169236 - 32169455
Alignment:
| Q |
203 |
gtttctatttcaaatagtcgtaaaatccatgttataaatgaacatcttttattatgagtagtttacttgtatagatagatttgtatcaatactctgagaa |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169236 |
gtttctatttcaaatagtcgtaaaatccatgttataaatgaacatcttttattatgagtagtt-acttgtatagatagatttgtatcaatactctgagaa |
32169334 |
T |
 |
| Q |
303 |
tatacaattattcatggcaacaacacacgccatcttcattacacttgccacccctagcaaacccagtatttgaacaaaaaacagcacaatagtcactata |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169335 |
tatacaattattcatggcaacaacacacgccatcttcattacacttgccacccctagcaaacccagtatttgaacaaaaaacagcacaatagtcactata |
32169434 |
T |
 |
| Q |
403 |
ttttgcacatggtcctttgct |
423 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32169435 |
ttttgcacatggtcctttgct |
32169455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 37 - 110
Target Start/End: Original strand, 32169070 - 32169143
Alignment:
| Q |
37 |
cattaatatgatacttatttttatgagtaagaaatcaattcaatacggtgaagtttacaacactcatactccgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169070 |
cattaatatgatacttatttttatgagtaagaaatcaattcaatacggtgaagtttacaacactcatactccgg |
32169143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University