View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_30 (Length: 393)
Name: NF3856_low_30
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 100 - 375
Target Start/End: Complemental strand, 10794417 - 10794142
Alignment:
| Q |
100 |
caatttcaagagaattaatgcggaagataatgagtttttgatttctccgaagaggaggtaagaaaggcggtctgggattgtgatagttcagactcagaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10794417 |
caatttcaagagaattaatgcggaagataatgagtttttgatttctccgaagaggaggtaagaaaggcggtctgggattgtgatagttcagactcagaaa |
10794318 |
T |
 |
| Q |
200 |
atccgggtcctgatggagttaatttcacgtttgttaaggagttttgggagcttattaaagttgatttcttgagggtagtgatggaatttcatactaatgg |
299 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10794317 |
atcctggtcctgatggagttaatttcacgtttgttaaggagttttgggagcttattaaagtggatttcttgagggtagtgatggaatttcatactaatgg |
10794218 |
T |
 |
| Q |
300 |
aaaacttgttaaaggtaatgattgtttgtttgtaatgcttgttcctaagaaatataatccaatgaatgtgtctgat |
375 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10794217 |
aaaacttgttaaaggtaatgattgttcgtttgtaatgcttgttcctaagaaatataatccaatgaatgtgtctgat |
10794142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University