View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_48 (Length: 300)
Name: NF3856_low_48
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 11 - 292
Target Start/End: Original strand, 55208037 - 55208319
Alignment:
| Q |
11 |
cacagatcatgcacttggaaatctaaattcattgaattgattcattcattcatcatagtataaccaaacaaacaaatgcctctgaccgatttttgagtca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55208037 |
cacagatcatgcacttggaaatctaaattcattgaattgattcattcattcatcatagtataaccaaacaaacaaatgcctctgaccgatttttgagtca |
55208136 |
T |
 |
| Q |
111 |
caaaatctgcatgtggtttattgtttggtgtttaccgcgttccacacactcctc-ttaaagctcacactacactataaattaggaagaaaatcatatttc |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55208137 |
caaaatctgca-gtggtttattgtttggtgtttaccgcgttccacacactcctctttaaagctcacactacactataaattaggaacaaaatcatatttc |
55208235 |
T |
 |
| Q |
210 |
catttcag-tactcctatttttcttcattcaaaatcatgttctttcaagtcattgccagccacaaacaaacaaaactctctgat |
292 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55208236 |
catttcagttactcctatttttcttcattcaaaatcatgttctttcaagtcattgccagccacaaacaaacaaaactctctgat |
55208319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University