View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_60 (Length: 251)
Name: NF3856_low_60
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_60 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 22 - 251
Target Start/End: Complemental strand, 9901988 - 9901759
Alignment:
| Q |
22 |
acacacgtagaaaacatttgaacgacatttgtttttt-gaataacnnnnnnnnntgcatagtttattacccgtgcgcattacacggattatatgaatgaa |
120 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9901988 |
acacacctagaaaacatttgaatgacatttgtttttttgaataacaaaaaaaa-tgcatagtttattacccgtgcgcattacacggattatatgaatgaa |
9901890 |
T |
 |
| Q |
121 |
agccatcgcatagaaccgtatttgttttgtgttcatcccacttgcgtcattgatgactacgttgggtttggttgaagttagaggaaataatcaannnnnn |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9901889 |
agccatcgcatagaaccgtatttgttttgtgttcatcccacttgcgtcattgatgactacgttgggtttggttgaagttagaggaaataatcaatttttt |
9901790 |
T |
 |
| Q |
221 |
nactcccacatgattggggtaccaatttgcc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9901789 |
tactcccacatgattggggtaccaatttgcc |
9901759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University