View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_61 (Length: 251)
Name: NF3856_low_61
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_61 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 139 - 245
Target Start/End: Original strand, 11301561 - 11301667
Alignment:
| Q |
139 |
tgaaaagacctatatgtgtttgatctaacataacataaaaaatcaaggtttcatttttagataggtcttttcattagtggatactcgttaaactactttc |
238 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| | ||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11301561 |
tgaaaagacctatatgcgtttgatctaacataacataaaaagttaaggtttcattctcagataggtcttttcattagtggatactcgttaaactactttc |
11301660 |
T |
 |
| Q |
239 |
tctgtgc |
245 |
Q |
| |
|
|| |||| |
|
|
| T |
11301661 |
tccgtgc |
11301667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 11301422 - 11301490
Alignment:
| Q |
1 |
taacacctactttagtcgtgattttcactcaaaatattaattattttgtactatgatgtgaatttttat |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11301422 |
taacacctactttagtcgtgattttcactcaaaatattaattattttgtactatgatgtgaatttttat |
11301490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 141 - 195
Target Start/End: Complemental strand, 10089142 - 10089088
Alignment:
| Q |
141 |
aaaagacctatatgtgtttgatctaacataacataaaaaatcaaggtttcatttt |
195 |
Q |
| |
|
|||||||| ||||| |||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10089142 |
aaaagaccaatatgcgtttgatctagcatagcataaaaaatcaaggtttcatttt |
10089088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University