View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_66 (Length: 247)
Name: NF3856_low_66
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_66 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 32875039 - 32874800
Alignment:
| Q |
1 |
atacatccattgctaatctctctgttgttgatgagagcactcaaagatacagaatttgtaaaagggctcaaaacatctcctataacaccaagagggtcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875039 |
atacatccattgctaatctctctgttattgatgagagcactcaaagatacagaatttgtaaaagggctcaaaacatctcctataacaccaagagggtcga |
32874940 |
T |
|
| Q |
101 |
ccaaattttgtggcatgatattcttcttgatagatagatagatagataattcaactggacctcgtttggtgttggcagcatgtttatgcatacacctgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874939 |
ccaaattttgtggcatgatattcttcttgatagatagatagatagataattcaaccggacctcgtttggtgttggcagcatgtttatgcatacacctgca |
32874840 |
T |
|
| Q |
201 |
cttatagataaattttgttcctttgtatctacctttgctt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32874839 |
cttatagataaattttgttcctttgtatctacttttgctt |
32874800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University