View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_67 (Length: 242)
Name: NF3856_low_67
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_67 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 242
Target Start/End: Complemental strand, 45521691 - 45521464
Alignment:
| Q |
15 |
aagtatcacatcttcacttctgtaatatagatttggattctctccatctacttgttgtgctatgctactcaccaaacctttgtgtgttaacatcacccct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45521691 |
aagtatcacatcttcacttctgtaatatagatttggattctctccatctacttgctgtgcaatgctactcaccaaacctttgtgtgttaacataacccct |
45521592 |
T |
|
| Q |
115 |
tttggtagacctgttgttcctgatgaatatggcagcgcaacaacatcgtctggatggatctttgcatcaggaagatgatcattctcatctgcttcttgga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521591 |
tttggtagacctgttgttcctgatgaatatggcagcgcaacaacatcgtctggctggatctttgcatcaggaagatgatcattctcatctgcttcttgga |
45521492 |
T |
|
| Q |
215 |
tgatcagcgttgagaaatggacatgatc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45521491 |
tgatcagcgttgagaaatggacatgatc |
45521464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 16 - 161
Target Start/End: Complemental strand, 350692 - 350547
Alignment:
| Q |
16 |
agtatcacatcttcacttctgtaatatagatttggattctctccatctacttgttgtgctatgctactcaccaaacctttgtgtgttaacatcacccctt |
115 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||| ||||||| ||||||||||||| ||| || |||| |
|
|
| T |
350692 |
agtatgacatcttcactgtgataatatagatttggattttctccatcaacttgttgtgctatgcttgtcaccaaccctttgtgtgttagcataacacctt |
350593 |
T |
|
| Q |
116 |
ttggtagacctgttgttcctgatgaatatggcagcgcaacaacatc |
161 |
Q |
| |
|
| |||||||| |||||||| ||||||||||||| ||||| ||||| |
|
|
| T |
350592 |
taggtagaccggttgttccagatgaatatggcaatgcaaccacatc |
350547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 74
Target Start/End: Complemental strand, 1445003 - 1444971
Alignment:
| Q |
42 |
tagatttggattctctccatctacttgttgtgc |
74 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
1445003 |
tagatttggattctctccatccacttgttgtgc |
1444971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University