View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_74 (Length: 232)
Name: NF3856_low_74
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 24 - 220
Target Start/End: Original strand, 44240705 - 44240901
Alignment:
| Q |
24 |
gcatgtactccaccgacgcttccgataaatctccggtacggaagcaatgcgttcagcttttcggattactctccgaaactcacggtaacacgctttctcc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44240705 |
gcatgtactccaccgacgcttccgataaatctccggtacggaagcaatgcgtccagcttttcggattactctccgaaactcacggtaacacgctttctcc |
44240804 |
T |
|
| Q |
124 |
ttacctgtcgaagatcctcgccaacgtaattcgacggcttcgtgataccgactcgtcggtccgatccgcgtgtgtgaattccgtttcagtattatct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44240805 |
ttacctgtcgaagatcctcgccaacgtaattcgacggcttcgtgataccgactcgtcggtccgatccgcgtgtgtgaattccgtttcagcattatct |
44240901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University