View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_75 (Length: 232)
Name: NF3856_low_75
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 95 - 219
Target Start/End: Complemental strand, 9901480 - 9901356
Alignment:
| Q |
95 |
aatgataatatattgtatactttgttttaatccctttgaattaaggtttaaattcatcttttgccattgtgcaattttgactctacacaatttaagaaag |
194 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9901480 |
aatgataatatattatatactttgttttaagccctttgaattaaggtttaaattcatcttttgccattgtgcaattttgactctacacaatttaagaaag |
9901381 |
T |
 |
| Q |
195 |
atttggaccataaataaactttttg |
219 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9901380 |
atttggaccataaataaactttttg |
9901356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 191
Target Start/End: Complemental strand, 22773408 - 22773324
Alignment:
| Q |
110 |
tatactttgttttaatccctttgaattaaggtttaa----attcatcttttgccattgtgcaattttgactctacacaatttaaga |
191 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||| || || |||||| |||||| ||||||| ||||| |||||||||||| |
|
|
| T |
22773408 |
tatactttgttttag-ccctttaaattaaggtttaattaaatccaccttttgtcattgtccaattttaactctccacaatttaaga |
22773324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University