View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_80 (Length: 217)
Name: NF3856_low_80
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_80 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 48960940 - 48960762
Alignment:
| Q |
20 |
gagaagtgttggctgtagttttctctggggaagaactacttgaatattgtgttgtcttttgaataggagaagatggcatcgaagaagatgaagaagaatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48960940 |
gagaagtgttggctgtagttttctctggggaagaactacttgaatattgtgttgtcttttgaataggagaagatggcatcgaagaagatgaagaagaatt |
48960841 |
T |
|
| Q |
120 |
aggaaacaagcccctatgaggtggagatgaaaatgtttgttctgttttcttttcttgaggttgagtctgattatgaggt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48960840 |
gggaaacaagcccctatgaggtggagatgaaagtgtttgttctgttttcttttcttgaggttgagtttgattatgaggt |
48960762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University