View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_81 (Length: 215)
Name: NF3856_low_81
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_81 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 42 - 198
Target Start/End: Complemental strand, 43122742 - 43122586
Alignment:
| Q |
42 |
tctactgacccagtaggaagattatcaacatagctgattaacatgctaagcttgctgccaccttcagatgcaagaccagcatgcatctcaacatccatag |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43122742 |
tctactgacccagtaggaagattatcaacatagctgattaacatgctaagcttgctgccaccttcagatgcaagaccagcatgcatctcaacatccatag |
43122643 |
T |
 |
| Q |
142 |
catcagccaactgtctaagctttccaattggtgtctcacacttttccccaaactcct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43122642 |
catcagccaactgtctaagctttccaattggtgtctcacacttttccccaaactcct |
43122586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 49 - 130
Target Start/End: Original strand, 4578452 - 4578533
Alignment:
| Q |
49 |
acccagtaggaagattatcaacatagctgattaacatgctaagcttgctgccaccttcagatgcaagaccagcatgcatctc |
130 |
Q |
| |
|
|||| |||||||||||||||||| | ||||| | ||| | ||||| || ||||| ||||| ||||||||||| |||||||| |
|
|
| T |
4578452 |
accctgtaggaagattatcaacaaaactgataagcattttgagcttactaccaccatcagaagcaagaccagcgtgcatctc |
4578533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University