View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3856_low_84 (Length: 211)
Name: NF3856_low_84
Description: NF3856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3856_low_84 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 22 - 195
Target Start/End: Complemental strand, 7288416 - 7288243
Alignment:
| Q |
22 |
tatcactagtaaaatagataaatttactattagtaacaataaggtgtaataaaatcataaaacacttaagaaaattattaatatgtatttaaatcttaac |
121 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7288416 |
tatcaatagtaaaatagataaatttactattagtaacaataaggtgtaataaaatcataaaacacttaagaaaattattaatatgtatttaaatcttaac |
7288317 |
T |
 |
| Q |
122 |
gtgttcgggattcctctagcttcaatgatttctatgttcataaagtcaaatcttttgttaccaagtagcaagct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7288316 |
gtgttcgggattcctctagcttcaatgatttctatgttcataaagtcaaatcttttgttaccaagtagcaagct |
7288243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University