View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_high_51 (Length: 264)
Name: NF3857_high_51
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_high_51 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 264
Target Start/End: Original strand, 46283800 - 46284067
Alignment:
| Q |
12 |
agagagtacaattattatttctatccaaccaaccatccatatatatgtatgcagtatacttgtagctagctagccaatatgctccctttgactggggttg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46283800 |
agagagtacaattattatttctatccaaccaaccatccatatatatgtatgcagtatacttgtagctagctagccaatatgctccctttgactggggttg |
46283899 |
T |
 |
| Q |
112 |
ctcagaacatcactttcaccaaaaagagatgcaccatcactctttctttgtggtgtata---------------agtagatgtccatgtatgatgtatct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46283900 |
ctcagaacatcactttcaccaaaaagagatgcaccatcactctttctttgtggtgtatagtattgtagatatatagtagatgtccatgtatgatgtatct |
46283999 |
T |
 |
| Q |
197 |
atatctatccatcacatctatttgagaatgttgtagtagttattggttccctcttcccatgtgtgctt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46284000 |
atatctatccatcacatctatttgagaatgttgtagtagttattggttccctcttcccatgcgtgctt |
46284067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University