View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_high_53 (Length: 253)
Name: NF3857_high_53
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_high_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 37538190 - 37538402
Alignment:
| Q |
1 |
ctcacatcaacagggaaaagatatttcatttgtgggataataggacattgcagccaaggaatgaaggttgaaattgacacgcttgccgctcaagtttctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37538190 |
ctcacatcaacagggaaaagatatttcatttgtgggacaataggacattgcagccaaggaatgaaggttgaaattgacacgcttgccgctcaagtttctc |
37538289 |
T |
|
| Q |
101 |
ctgcctcaccagtagcagcagcaccttcaatagcagactctccaatgatttccatcattccctctgcagcacctgcagaatctactgtttcatctgcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37538290 |
ctgcctcaccagtagcagcagcaccttcaatagcagactctccaatgatttccatcattccctctgcagcacctgcagaatctactgtttcatctgcaga |
37538389 |
T |
|
| Q |
201 |
atctcctgaagca |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37538390 |
atctcctgaagca |
37538402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 239
Target Start/End: Original strand, 37538417 - 37538449
Alignment:
| Q |
207 |
tgaagcacaagtggaaagtcctacactctctcc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37538417 |
tgaagcacaagtggaaagtcctacactctctcc |
37538449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University