View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_high_72 (Length: 224)
Name: NF3857_high_72
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_high_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 40 - 147
Target Start/End: Complemental strand, 19119096 - 19118993
Alignment:
| Q |
40 |
ttagcaaagagctaagagataatgtaaattggttagtagatcgataaaacatttgagtatatttgaaatttatttattagttaatattgattcttatgtt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19119096 |
ttagcaaagagctaagagataatgtaaattggt----agatcgataaaacatttgagtatatttgaaatttatttattagttaatattgattcttatgtt |
19119001 |
T |
 |
| Q |
140 |
atgcaaat |
147 |
Q |
| |
|
|||||||| |
|
|
| T |
19119000 |
atgcaaat |
19118993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University