View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_high_74 (Length: 219)
Name: NF3857_high_74
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_high_74 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 20 - 185
Target Start/End: Original strand, 42278603 - 42278768
Alignment:
| Q |
20 |
ataagaaaataagctagttagataaaccaattatatttgtacatgcattgtgaggacagtatccctttgcatagatgtccaataaaacaagcaccaatga |
119 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42278603 |
ataagaaaacaagctagttagataaaccaattatatttgtacatgcattgtgaggacagtatccctttgcatagaggtccaataaaacaagcaccaatga |
42278702 |
T |
 |
| Q |
120 |
agcttgctaatgacattacaaaatcctctaacaagaactgggatttggataaaatttccacaggtt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42278703 |
agcttgctaatgacattacaaaatcctctaacaagaactgggatttggataaaatttccacaggtt |
42278768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University