View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_low_12 (Length: 495)
Name: NF3857_low_12
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_low_12 |
 |  |
|
| [»] scaffold0007 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 81; Significance: 6e-38; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 271 - 360
Target Start/End: Complemental strand, 147106 - 147015
Alignment:
| Q |
271 |
ggagactgcacgaatagatggctctgcttcaatgagaaattgctttgcttatgac--aacaattttggctttgttcacatttcttaaaatta |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
147106 |
ggagactgcacgaatagatggctctgcttcaatgagaaattgctttgcttatgacaaaacaattttggctttgttcacatttcttaaaatta |
147015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 11 - 67
Target Start/End: Complemental strand, 147367 - 147311
Alignment:
| Q |
11 |
gagaggggttgtcacttgtcatgattgtactatttttctgaaaaacgcggctccaag |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
147367 |
gagaggggttgtcacttgtcatgattgtactatttttctgaaaaacgcggctccaag |
147311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 141 - 187
Target Start/End: Complemental strand, 147237 - 147191
Alignment:
| Q |
141 |
gggttgaagttagttcattcaatgttagttatgctgtgtatgttgaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
147237 |
gggttgaagttagttcattcaatgttagttatgctgtgtatgttgaa |
147191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University