View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_low_36 (Length: 329)
Name: NF3857_low_36
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 33813078 - 33813389
Alignment:
| Q |
1 |
aactatatagagatacagtatcttgacttgggatattcattgtataatcacatgctaattgagctagttaacggtaatgatgaacttaattagagtacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33813078 |
aactatatagagatacagtatcttgacttgggatattcattgtataatcacatgctaattgagctagttaacggtaatgatgaacttaattagagtacaa |
33813177 |
T |
 |
| Q |
101 |
taaattaaatatcaaaagggacgagtgaataattagttaatccttattcagctcaataaaggctgcccaaaatttcaaaatccaagaaggatcaactcgt |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33813178 |
tatattaaatatcaaaagggacgagtgagtaattagttaatccttattcagctcaataaaggctgcccaaaatttcaaaatccaagaaggatcaactcgt |
33813277 |
T |
 |
| Q |
201 |
agataactagcattggtaacataaaattctcttgaacagtcactcacatttggtcgtcatggttttttgtgggctcaaatttagttgtcagaaattcctc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33813278 |
agataactagcattggtaacataaaattctcttgaacagtcactcacatttggtcgtcatggttttttgtgggctcaaatttagttgtcagaaattcctc |
33813377 |
T |
 |
| Q |
301 |
acatacatagct |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33813378 |
acatacatagct |
33813389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University