View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3857_low_43 (Length: 292)
Name: NF3857_low_43
Description: NF3857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3857_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 15 - 281
Target Start/End: Original strand, 8914361 - 8914627
Alignment:
| Q |
15 |
caataataacttcaacactatccaaaaccagtctatttttctttaagccaaatcctatacttaagcatatttacttaccatatgcttatgcttttgttga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8914361 |
caataataacttcaacactatccaaaaccagtttatttttctttaagccaaatcctatacttaagcatatttacttaccatatgcttatgcttttgttga |
8914460 |
T |
 |
| Q |
115 |
gggttactttctcttgaatccacttagcgatattttttctctttctatcattcttaatagcagtgttagattccatatagattaggtctccctaatttta |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8914461 |
gggttactttctcttgaatccactttgcgatattttttctctttctatcattcttaatagcagtgttagattccatatagattaggtctccctaatttta |
8914560 |
T |
 |
| Q |
215 |
tattttgttgaatttgtttaggaatgcaccatctttttgttttctttatttcttatcaaatgatatt |
281 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8914561 |
tattttgttgaatttgtttagggttgcaccatctttttgttttctttatttcttatcaaatgatatt |
8914627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University